Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU063491

Sigma-Aldrich

MISSION® esiRNA

targeting human ELAVL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCT

Ensembl | nº de acceso humano

ENSG00000066044

Nº de acceso NCBI

NM_001419

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ELAVL1(1994) , ELAVL1(1994)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guillaume Gauchotte et al.
The Journal of pathology, 242(4), 421-434 (2017-05-12)
HuR regulates cytoplasmic mRNA stability and translatability, and the HuR expression level has been shown to correlate with poor disease outcome in several cancer types; however, the prognostic value and potential pro-oncogenic properties of HuR in meningioma remain unclear. Thus
Kotb Abdelmohsen et al.
RNA biology, 14(3), 361-369 (2017-01-13)
HuR influences gene expression programs and hence cellular phenotypes by binding to hundreds of coding and noncoding linear RNAs. However, whether HuR binds to circular RNAs (circRNAs) and impacts on their function is unknown. Here, we have identified en masse
Aya Yanagawa-Matsuda et al.
Oncology reports, 41(2), 954-960 (2018-11-16)
AU-rich elements (AREs) are RNA elements that enhance the rapid decay of mRNA. The fate of ARE-mRNA is controlled by ARE-binding proteins. HuR, a member of the embryonic lethal abnormal vision (ELAV) family of RNA-binding proteins, is involved in the
Prachi Matsye et al.
Glia, 65(6), 945-963 (2017-03-17)
In neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), chronic activation of microglia contributes to disease progression. Activated microglia produce cytokines, chemokines, and other factors that normally serve to clear infection or damaged tissue either directly or through the recruitment
Shuran Li et al.
Science China. Life sciences, 60(6), 617-626 (2017-06-25)
APOBEC3 protein families, a DNA cytidine deaminase, were up-regulated in multiple tumors. However, the relationship between Hepatocellular carcinoma (HCC) and APOBEC3B (A3B) remains unknown. It has been confirmed that interleukin-6 (IL-6) has significant impacts on oncogenesis of HCC. Here, we
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico