Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU062671

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX10, MIR6820

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGAAGGCAGGAAGGAGTTGGCACAGAGGCCCCCTGATCCAATTCTGTGCCAATAACCTCATTCTTTGTCTGAGAAACAGCCCCCAGTCCTCCTCCACTACAACCTCCATGACCTTGAGACGCATCCCAGGAGGTGACGAGGCAGGGGCTCCAGGAAAGGAATCAGAGACAATTCACAGAGCCTCCCTCCCTGGGCTCCTTGCCAGCTCCCTCTTCCCTTACTAGGCTCTATGGCCCCTGCTCAGTCAGCCCCACTCCCTGGGCTTCCCAGAGAGTGACAGCTGCTCAGGCCCTAACCCTTGGCTCCAGGAGACACAGGGCCCAGCACCCAGGTTGCTGTCGGCAGGCTGAAGACACTAGAATCCTGACCTGTACATTCTGCCCTTGCCTCTTACCCCTTGCCTCCCAGTGGTATTT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carmen Bravo González-Blas et al.
Nature methods, 16(5), 397-400 (2019-04-10)
We present cisTopic, a probabilistic framework used to simultaneously discover coaccessible enhancers and stable cell states from sparse single-cell epigenomics data ( http://github.com/aertslab/cistopic ). Using a compendium of single-cell ATAC-seq datasets from differentiating hematopoietic cells, brain and transcription factor perturbations
Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell
Wen Feng et al.
Biochemical and biophysical research communications, 485(2), 522-528 (2017-02-13)
The mechanisms modulating the cancer stem cell (CSC) properties of triple negative breast cancer (TNBC) cells were not fully understood. In this study, we performed data mining in Breast Cancer Gene-Expression Miner v4.0 and found that TNBC tumors had significantly
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico