Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU062341

Sigma-Aldrich

MISSION® esiRNA

targeting human C1QTNF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATGCACAGCAACCACTACTACCAGACGGTGATCTTCGACACGGAGTTCGTGAACCTCTACGACCACTTCAACATGTTCACCGGCAAGTTCTACTGCTACGTGCCCGGCCTCTACTTCTTCAGCCTCAACGTGCACACCTGGAACCAGAAGGAGACCTACCTGCACATCATGAAGAACGAGGAGGAGGTGGTGATCTTGTTCGCGCAGGTGGGCGACCGCAGCATCATGCAAAGCCAGAGCCTGATGCTGGAGCTGCGAGAGCAGGACCAGGTGTGGGTACGCCTCTACAAGGGCGAACGTGAGAACGCCATCTTCAGCGAGGAGCTGGACACCTACATCACCTTCAGTGGCTACCTGGTCAAGCACGCCACCGAGCCCTAGCTGGCCGGCCACCTCCTTTCCTCTCGCCACCTTC

Ensembl | nº de acceso humano

ENSG00000173918

Nº de acceso NCBI

NM_198594

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... C1QTNF1(114897) , C1QTNF1(114897)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Huilin Wang et al.
Life sciences, 256, 117992-117992 (2020-06-23)
C1q/tumor necrosis factor-related protein-1 (CTRP1) is a newly identified adiponectin paralog that modulates metabolism and inflammation. However, the cerebral function of CTRP1 remains unknown. This study aimed to determine its role and mechanism in cerebral ischemia and reperfusion injury. Serum
Leiming Wu et al.
Free radical biology & medicine, 121, 215-230 (2018-05-08)
Complement C1q tumor necrosis factor related proteins (C1QTNFs) have been reported to have diverse biological influence on the cardiovascular system. C1QTNF1 is a member of the CTRP superfamily. C1QTNF1 is expressed in the myocardium; however, its function in myocytes has

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico