Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU062171

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCCAAGCATAAGGTCTGCCGAAGCCTTGGCGTTCTCAGACTGCCGGCTGCACATCTGCCTGTACTACCGGGAAATCCTCGTGAAGGAGCTGACCACGTCCAGCCCCGAGGGCTGCCGGATCTCCCATGGACATACGTATGACGCCAGCAACCTGGACCAGGTCCTGTTCCCCTACCCAGAGGACAATGGCCAGAGGAAAAACATTGAGAAGCTGCTGAGCCACCTGGAGAGGGGCGTGGTCCTCTGGATGGCCCCCGACGGGCTCTATGCGAAAAGACTGTGCCAGAGCAGGATCTACTGGGACGGGCCCCTGGCGCTGTGCAACGACCGGCCCAACAAACTGGAGAGAGACCAGACCTGCAAGCTCTTTGACACACAGCAGTTCTTGTCAGAGCTGCAAGCGTTTGCTCACCACGGCCGCTCCCTGCCAAGATTCCAGGTGACTCTATGCTTTGGAGAGGAGTTTCCAGACCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Takuya Yashiro et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11481-11491 (2019-07-18)
C-C chemokine receptor type 7 (CCR7) is essential for migration of dendritic cells (DCs) to draining lymph nodes. PU.1/Spi1 is a transcription factor playing a critical role in the gene regulation of DCs. PU.1 knockdown decreased the expression of CCR7
Diego Barriales et al.
PLoS biology, 19(1), e3001062-e3001062 (2021-01-05)
Lyme carditis is an extracutaneous manifestation of Lyme disease characterized by episodes of atrioventricular block of varying degrees and additional, less reported cardiomyopathies. The molecular changes associated with the response to Borrelia burgdorferi over the course of infection are poorly
Takuya Yashiro et al.
Scientific reports, 9(1), 1161-1161 (2019-02-06)
The chemokine CCL22 is predominantly produced by dendritic cells (DCs) and macrophages. CCL22 acts on CCR4-expressing cells including Th2 and Treg. Although a correlation between the CCL22-CCR4 axis and allergic diseases has been established, the mechanism of monocyte lineage-specific Ccl22
T Watanabe et al.
Mucosal immunology, 7(6), 1312-1325 (2014-03-29)
It is well established that polymorphisms of the caspase activation and recruitment domain 15 (CARD15) gene, a major risk factor in Crohn's disease (CD), lead to loss of nucleotide-binding oligomerization domain 2 (NOD2) function. However, a molecular explanation of how
Sorim Nam et al.
Journal of leukocyte biology, 100(6), 1273-1284 (2016-09-08)
Myeloid-derived suppressor cells (MDSCs) are immature cells that do not differentiate into mature myeloid cells. Two major populations of PMN-MDSCs (Ly6G

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico