Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU061641

Sigma-Aldrich

MISSION® esiRNA

targeting human UVRAG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGAGCACCTCAAACTTCAACTCCAGAAGGAATCCCTAAATGAGCTGAGGAAGGAGTGCACTGCAAAAAGAGAACTCTTCTTGAAGACTAATGCTCAGTTGACAATTCGTTGCAGGCAGTTACTCTCTGAGCTTTCCTACATTTACCCTATTGATTTGAATGAACATAAGGATTACTTTGTATGCGGTGTCAAGTTGCCTAATTCTGAGGACTTCCAAGCAAAAGATGATGGAAGCATTGCTGTTGCCCTTGGTTATACTGCACATCTGGTCTCCATGATTTCCTTTTTCCTACAAGTGCCCCTCAGATATCCTATAATTCATAAGGGGTCTAGATCAACAATCAAAGACAATATCAATGACAAACTGACGGAAAAGGAGAGAGAGTTTCCACTGTATCCAAAAGGAGGGGAGAAGT

Ensembl | nº de acceso humano

ENSG00000198382

Nº de acceso NCBI

NM_003369

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... UVRAG(7405) , UVRAG(7405)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianwen Wang et al.
OncoTargets and therapy, 13, 10275-10285 (2020-10-30)
Radiotherapy is one of the most important methods in the treatment of patients with hypopharyngeal squamous cell carcinoma (HSCC). However, radioresistance will be developed after repeated irradiation. Among many key factors contributing to radioresistance, enhanced autophagy is recognized as one
Haoyuan Deng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2171-2182 (2017-04-26)
Atherosclerosis is a multifactorial chronic disease and is the main cause of death and impairment in the world. Endothelial injury and apoptosis play a crucial role in the onset and development of atherosclerosis. MicroRNAs (miRNAs) have been proven to be
Yunha Kim et al.
Autophagy, 11(5), 796-811 (2015-05-07)
The EWSR1 (EWS RNA-binding protein 1/Ewing Sarcoma Break Point Region 1) gene encodes a RNA/DNA binding protein that is ubiquitously expressed and involved in various cellular processes. EWSR1 deficiency leads to impairment of development and accelerated senescence but the mechanism

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico