Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU061331

Sigma-Aldrich

MISSION® esiRNA

targeting human PBX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGGGCAGGTTCAGACAACTCAGTGGAGCATTCAGATTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCATACGGAGCTGGAGAAATACGAGCAGGCCTGCAACGAGTTCACCACCCACGTGATGAATCTCCTGCGAGAGCAAAGCCGGACCAGGCCCATCTCCCCAAAGGAGATTGAGCGGATGGTCAGCATCATCCACCGCAAGTTCAGCTCCATCCAGATGCAGCTCAAGCAGAGCACGTGCGAGGCGGTGATGATCCTGCGTTCCCGATTTCTGGATGCGCGGCGGAAGAGACGGAATTTCAACAAGCAAGCGACAGAAATCCTGAATGAATATTTCTATTCCCATCTCAGCAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGTGGCATCACA

Ensembl | nº de acceso humano

ENSG00000185630

Nº de acceso NCBI

NM_002585

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PBX1(5087) , PBX1(5087)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Changyu He et al.
Oncotarget, 8(29), 46818-46833 (2017-05-18)
Pre-B-cell leukemia homeobox 1 (PBX1) was originally identified as a proto-oncogene in human leukemia. Although this protein has been shown to contribute to cellular development and tumorigenesis, the role of PBX1 in gastric carcinoma (GC) remains unclear. In this study
Xin Wei et al.
Biochemical and biophysical research communications, 500(3), 650-657 (2018-04-22)
PBX1 was abnormally overexpressed and its intracellular localization was found to be frequently amplified in many types of cancer, including renal clear cell carcinoma. PBX1 displays oncogenic activity in several different types of cells, but little is known about how
Chiou-Hong Lin et al.
Scientific reports, 9(1), 4915-4915 (2019-03-22)
The PBX1 homeodomain transcription factor is converted by t(1;19) chromosomal translocations in acute leukemia into the chimeric E2A-PBX1 oncoprotein. Fusion with E2A confers potent transcriptional activation and constitutive nuclear localization, bypassing the need for dimerization with protein partners that normally
Yonggang Zhou et al.
Science translational medicine, 12(537) (2020-04-03)
Abundant decidual natural killer (dNK) cells at the maternal-fetal interface are important during early pregnancy. However, functional subsets of dNK cells remain poorly understood. We describe a CD49a+PBX homeobox 1 (PBX1)+ dNK cell subset that promotes fetal development in humans

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico