Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU061041

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAP23

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCACCATTCAGGAACACTTTATATAAATGAGTGGCTTTTTATTTCATATTATTAGTAGTATCATGGTTCCATTACAGGCCTATTAACATCATACATTGTCATTAGTCTTTGAAGAAAAAATATGTAAATATATATGTGTAACATGAGAATTTCTCTCTAAAGCAGGGCTTAAAATTTTTTGGAAAAGTTTGACAAAGCATACCACATGAATTCAGATTTACCTCAATGCTAAGAATTATGTTTAGTTAGGAAAAAGGAAAGTCATTTTGACCTCAGGTAGAAAAATAGATTGCTTTGAGTTTTATGTAGCTTTAGACTTTAAAAAGTTAGAATTTATTCTGTAACTAAAAATTATTTGAAAAAATTATGCCTCTGGTTTAATTATTGGTGATTACACACTCTTTCTCTTACCCTTGTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Roxana Khazen et al.
Nature communications, 7, 10823-10823 (2016-03-05)
Human melanoma cells express various tumour antigens that are recognized by CD8(+) cytotoxic T lymphocytes (CTLs) and elicit tumour-specific responses in vivo. However, natural and therapeutically enhanced CTL responses in melanoma patients are of limited efficacy. The mechanisms underlying CTL
Daiki Kinoshita et al.
Molecular biology of the cell, 30(9), 1085-1097 (2019-02-28)
Syntaxin 11 (stx11) is a soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) that is selectively expressed in immune cells; however, its precise role in macrophages is unclear. We showed that stx11 knockdown reduces the phagocytosis of Escherichia coli in interferon-γ-activated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico