Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU060561

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKBIZ

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCTGGCTAGCAACACTCACTGTCAGTTAGGCAGTCCTGATGTATCTGTACATAGACCATTTGCCTTATATTGGCAAATGTAAGTTGTTTCTATGAAACAAACATATTTAGTTCACTATTATATAGTGGGTTATATTAAAAGAAAAGAAGAAAAATATCTAATTTCTCTTGGCAGATTTGCATATTTCATACCCAGGTATCTGGGATCTAGACATCTGAATTTGATCTCAATGGTAACATTGCCTTCAATTAACAGTAGCTTTTGAGTAGGAAAGGACTTTGATTTGTGGCACAAAACATTATTAATATAGCTATTGACAGTTTCAAAGCAGGTAAATTGTAAATGTTTCTTTAAGAAAAAGCATGTGAAAGGAAAAAGGTAAATACAGCATTGAGGCTTCATTTGGCCTTAGTCCCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Abhirup Mandal et al.
Science advances, 6(30), eabb6049-eabb6049 (2020-08-25)
Systemic antibodies targeting tumor necrosis factor-α (TNF-α) and interleukin-17A (IL-17A) are effective in plaque psoriasis. Despite their popularity, safety concerns pose a challenge for systemic biologics. While anti-TNF-α and anti-IL-17A antibodies effectively inhibit respective proteins, we hypothesize that an approach
Zhiwen Liu et al.
JCI insight, 5(24) (2020-12-18)
Sepsis is the leading cause of acute kidney injury (AKI). However, the pathogenesis of septic AKI remains largely unclear. Here, we demonstrate a significant decrease of microRNA-376b (miR-376b) in renal tubular cells in mice with septic AKI. Urinary miR-376b in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico