Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU060231

Sigma-Aldrich

MISSION® esiRNA

targeting human FAS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCAAGTTGCTGAATCAATGGAGCCCTCCCCAACCCGGGCGTTCCCCAGCGAGGCTTCCTTCCCATCCTCCTGACCACCGGGGCTTTTCGTGAGCTCGTCTCTGATCTCGCGCAAGAGTGACACACAGGTGTTCAAAGACGCTTCTGGGGAGTGAGGGAAGCGGTTTACGAGTGACTTGGCTGGAGCCTCAGGGGCGGGCACTGGCACGGAACACACCCTGAGGCCAGCCCTGGCTGCCCAGGCGGAGCTGCCTCTTCTCCCGCGGGTTGGTGGACCCGCTCAGTACGGAGTTGGGGAAGCTCTTTCACTTCGGAGGATTGCTCAACAACCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FAS(355) , FAS(355)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Neetu Singh et al.
European journal of pharmacology, 815, 462-469 (2017-10-05)
Endothelial dysfunction plays an important role in structural remodeling occurring in the pulmonary vasculature during pulmonary hypertension (PH). Endothelial injury causes apoptosis and activation of endothelial cells. However, some endothelial cells show apoptosis-resistance and later proliferate extensively leading to vascular
Chen-Ting Lee et al.
Radiation research, 188(2), 169-180 (2017-06-10)
Breast cancer is the most common malignancy diagnosed among women and represents a heterogeneous group of subtypes. Radiation therapy is a critical component of treatment for breast cancer patients. However, little is known about radiation response among these intrinsic subtypes.
Sara Cuadrado-Castano et al.
Molecular cancer therapeutics, 14(5), 1247-1258 (2015-03-13)
Newcastle disease virus (NDV) is considered a promising agent for cancer therapy due to its oncolytic properties. These include preferential replication in transformed cells, induction of innate and adaptive immune responses within tumors, and cytopathic effects in infected tumor cells
K Mizrahi et al.
Bone marrow transplantation, 49(7), 942-949 (2014-04-30)
The influence of TNF-α and Fas-ligand (FasL) on viability and function was evaluated in fresh- and expanded-umbilical cord blood (UCB) cells. CD34(+) progenitors and T cells display outstanding survival, whereas ~30% and >50% B lymphocytes and myeloid cells undergo spontaneous
Janet K Horton et al.
Radiation research, 184(5), 456-469 (2015-10-22)
Although a standardized approach to radiotherapy has been used to treat breast cancer, regardless of subtype (e.g., luminal, basal), recent clinical data suggest that radiation response may vary significantly among subtypes. We hypothesized that this clinical variability may be due

Artículos

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico