Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU058281

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAAAGCTGGGGGATAGAGGGGCTGCAGGGCCACTGGAAGGAACATGGAGCTGTC

Ensembl | nº de acceso humano

ENSG00000167779

Nº de acceso NCBI

NM_002178

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IGFBP6(3489) , IGFBP6(3489)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 688-692 (2018-03-28)
IGFBP6 gene plays an important role in the pathogenesis of breast cancer. In this work, we performed knockdown of IGFBP6 gene in MDA-MB-231 cells and obtained a stable cell line. Knockdown of IGFBP6 gene was confirmed by the real-time PCR.
S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 650-654 (2018-03-27)
Protein IGFBP6 plays an important role in the pathogenesis of many malignant tumors, including breast cancer. The relationship between IGFBP6 protein and the expression of genes associated with the epithelial-mesenchymal transition is studied. Gene IGFBP6 knockdown does not trigger the
Song Wang et al.
Neurochemical research, 42(2), 455-467 (2016-11-27)
IGFBP6, a member of the insulin-like growth factor-binding proteins family that contains six high affinity IGFBPs, modulates insulin-like growth factor (IGF) activity and also showed an independent effect of IGF, such as growth inhibition and apoptosis. However, the role of
Zhecun Wang et al.
Journal of cellular physiology, 235(12), 9538-9556 (2020-06-13)
Despite the high prevalence of varicose veins, the underlying pathogenesis of this disease remains unclear. The present study aims to explore the role of insulin-like growth factor binding protein 6 (IGFBP6) in vascular smooth muscle cells (VSMCs). Using a protein
Keigo Sawada et al.
Biochemical and biophysical research communications, 464(1), 299-305 (2015-06-28)
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico