Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU056071

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAACCCTCCCAAGAAGTTCAGAGACTGCCTTTTCAAGGTGTGCCCTATGAACAGATATTCTGCCCAGAAGCAATATTGGAAAGCAAAGCAAGCCAAACAAGGGAACCACACCGAGGCAGCCTTGCTGAAGAAACTACAGCACGCTGCAGAACTGGAACAAAAACAAAATGAATCGGAGAATAAGAAACTGTTGGGAGAAATTGTAAAATACAGTAATGTTATACAACTACTGCATATAAAAAGCAACAAATATCTTACTGTCAACAAGAGATTACCTGCTTTACTGGAGAAGAATGCCATGCGTGTGTCCTTGGATGCTGCAGGAAATGAAGGGTCTTGGTTTTATATTCATCCGTTCTGGAAACTGAGAAGCGAGGGTGA

Ensembl | nº de acceso humano

ENSG00000123104

Nº de acceso NCBI

NM_002223

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ITPR2(3709) , ITPR2(3709)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico