Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU054511

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCATGGCCTGTACAACCTCAAACAGTGCAAGATGTCTCTGAACGGGCAGCGTGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCTGATCCAGGGAGCCCCCACCATCCGGGGGGACCCCGAGTGTCATCTCTTCTACAATGAGCAGCAGGAGGCTCGCGGGGTGCACACCCAGCGGATGCAGTAGACCGCAGCCAGCCGGTGCCTGGCGCCCCTGCCCCCCGCCCCTCTCCAAACACCGGCAGAAAACGGAGAGTGCTTGGGTGGTGGGTGCTGGAGGATTTTCCAGTTCTGACACACGTATTTATATTTGGAAAGAGACCAGCACCGAGCTCGGCACCTCCCCGGCCTCTCTCTTCCCAGCTGCAGATGCCACACCTGCTCCTTCTTGCTTT

Ensembl | nº de acceso humano

ENSG00000115457

Nº de acceso NCBI

NM_000597

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IGFBP2(3485) , IGFBP2(3485)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hiromichi Katayama et al.
Scientific reports, 7(1), 12016-12016 (2017-09-22)
Renal cell carcinoma (RCC) is one of the most lethal urologic cancers. About one-third of RCC patients already have distal metastasis at the time of diagnosis. There is growing evidence that Hox antisense intergenic RNA (HOTAIR) plays essential roles in
Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
S W Yau et al.
International journal of obesity (2005), 39(5), 770-781 (2014-11-06)
IGF-binding protein (IGFBP)-2 is the principal IGFBP produced by white adipocytes during adipogenesis, and circulating levels are reduced in obesity. Overexpression of IGFBP-2 in transgenic mice prevents obesity, but depot-specific effects of IGFBP-2 on adipo/lipogenesis are unknown. The present study
Steven W Yau et al.
Endocrinology, 155(6), 2133-2143 (2014-03-25)
Leptin is produced from white adipose tissue and acts primarily to regulate energy balance. Obesity is associated with leptin resistance and increased circulating levels of leptin. Leptin has recently been shown to influence levels of IGF binding protein-2 (IGFBP-2), a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico