Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052661

Sigma-Aldrich

MISSION® esiRNA

targeting human CSF1R

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGAGGCGTCGACTATAAGAACATCCACCTCGAGAAGAAATATGTCCGCAGGGACAGTGGCTTCTCCAGCCAGGGTGTGGACACCTATGTGGAGATGAGGCCTGTCTCCACTTCTTCAAATGACTCCTTCTCTGAGCAAGACCTGGACAAGGAGGATGGACGGCCCCTGGAGCTCCGGGACCTGCTTCACTTCTCCAGCCAAGTAGCCCAGGGCATGGCCTTCCTCGCTTCCAAGAATTGCATCCACCGGGACGTGGCAGCGCGTAACGTGCTGTTGACCAATGGTCATGTGGCCAAGATTGGGGACTTCGGGCTGGCTAGGGACATCATGAATGACTCCAACTACATTGTCAAGGGCAATGCCCGCCTGCCTGTGAAGTGGATGGCCCCAGAGAGCATCTTTGACTGTGTCTACACGGTTCAGAGCGACGTCTGGTCCTATGGCATCCTC

Ensembl | nº de acceso humano

ENSG00000182578

Nº de acceso NCBI

NM_005211

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CSF1R(1436) , CSF1R(1436)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ACNV
JUU
NRR
RPR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ladonya Jackson et al.
Journal of neuroinflammation, 17(1), 137-137 (2020-04-30)
Unfortunately, over 40% of stroke victims have pre-existing diabetes which not only increases their risk of stroke up to 2-6 fold, but also worsens both functional recovery and the severity of cognitive impairment. Our lab has recently linked the chronic
Thidarath Rattanaburee et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110361-110361 (2020-06-15)
Kusunokinin, a lignan compound, inhibits cancer cell proliferation and induces apoptosis; however, the role of kusunokinin is not fully understood. Here, we aimed to identify a target protein of (-)-kusunokinin and determine the protein levels of its downstream molecules. We
Xiaolong Shi et al.
Cellular and molecular gastroenterology and hepatology, 10(2), 391-418 (2020-04-19)
The miR-34a gene is a direct target of p53 and is commonly silenced in colorectal cancer (CRC). Here we identified the receptor tyrosine kinase CSF1R as a direct miR-34a target and characterized CSF1R as an effector of p53/miR-34a-mediated CRC suppression.
Qiang Chen et al.
Fish & shellfish immunology, 45(2), 386-398 (2015-05-10)
Colony-stimulating factor 1 receptor (CSF1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although CSF1R gene has been identified and functionally studied in many fish, the precise role of CSF1R in grass carp (Ctenopharyngodon idellus) remains unclear. In this study, we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico