Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU052611

Sigma-Aldrich

MISSION® esiRNA

targeting human CD99

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGATTGTCGGCAGAAACAGCCCAGGCGTTGGCAGCAGGGTTAGAACAGCTGCCTGAGGCTCCTCCCTGAAGGACACCTGCCTGAGAGCAGAGATGGAGGCCTTCTGTTCACGGCGGATTCTTTGTTTTAATCTTGCGATGTGCTTTGCTTGTTGCTGGGCGGATGATGTTTACTAACGATGAATTTTACATCCAAAGGGGGATAGGCACTTGGACCCCCATTCTCCAAGGCCCGGGGGGGCGGTTTCCCATGGGATGTGAAAGGCTGGCCATTATTAAGTCCCTGTAACTCAAATGTCAACCCCACCGAGGCACCCCCCCGTCCCCCAGAATCTTGGCTGTTTACAAATCACGTGTCCATCGAGCACGTCTGAAACCCCTGGTAGCCCCGACTTCTTTTT

Ensembl | nº de acceso humano

ENSG00000002586

Nº de acceso NCBI

NM_002414

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD99(4267) , CD99(4267)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lais C Cardoso et al.
International journal of molecular sciences, 20(5) (2019-03-09)
Glioblastoma (GBM) is the most aggressive type of brain tumor, with an overall survival of 17 months under the current standard of care therapy. CD99, an over-expressed transmembrane protein in several malignancies, has been considered a potential target for immunotherapy.
Tillmann Bedau et al.
Oncotarget, 8(33), 54873-54888 (2017-09-15)
Transendothelial cell migration (TEM) is crucial for inflammation and metastasis. The adhesion molecule CD99 was shown to be important for correct immune cell extravasation and is highly expressed on certain cancer cells. Recently, we demonstrated that ectodomain shedding of CD99
Jianfa Wu et al.
Biochemical and biophysical research communications, 518(4), 698-705 (2019-09-02)
Cisplatin resistance is a vital obstacle for the prognosis of ovarian cancer. However, the mechanism of cisplatin resistance is still unknown. This research was performed to explore the role of Nrf2 (nuclear factor, erythroid 2 like 2) and CD99 (CD99

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico