Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052551

Sigma-Aldrich

MISSION® esiRNA

targeting human THBS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGCTGGGTCTATTTGTCTTCTCTCAAGAAATGGTCTATTTCTCAGACCTCAAGTACGAATGCAGAGATATTTAAACAAGATTTGCTGCATTTCCGGCAATGCCCTGTGCATGCCATGGTCCCTAGACACCTCAGTTCATTGTGGTCCTTGTGGCTTCTCTCTCTAGCAGCACCTCCTGTCCCTTGACCTTAACTCTGATGGTTCTTCACCTCCTGCCAGCAACCCCAAACCCAAGTGCCTTCAGAGGATAAATATCAATGGAACTCAGAGATGAACATCTAACCCACTAGAGGAAACCAGTTTGGTGATATATGAGACTTTATGTGGAGTGAAAATTGGGCATGCCATTACATTGCTTTTTCTTGTTTGTTTAAAAAGAATGACGTTTACATATAAAATGTAATTACTTATTGTATTTATGTGTATATGGAGTTGAAGGGAATACTGTGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kyungha Shin et al.
World journal of stem cells, 11(12), 1115-1129 (2019-12-27)
Osteoarthritis (OA), a chronic age-related disease characterized by the slowly progressive destruction of articular cartilage, is one of the leading causes of disability. As a new strategy for treatment of OA, mesenchymal stem cells (MSCs) have the potential for articular
Q-H Liu et al.
European review for medical and pharmacological sciences, 22(19), 6230-6238 (2018-10-20)
Thrombospondin 2 (THBS2) expression and its prognostic value have been documented in several types of cancer. Nevertheless, the potential role and clinical significance of THBS2 in uveal melanoma (UM) have never been reported. Thus, in our study, we aimed to
Yingqin Ye et al.
Placenta, 103, 156-163 (2020-11-01)
Circ-AK2 has been found to be differentially expressed in PE placenta tissues, however, the role and the underlying molecular mechanisms of circ-AK2 in PE remain poorly known. The expression of circ-AK2, miR-454-3p, and THBS2 mRNA was detected using quantitative real-time

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico