Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU052491

Sigma-Aldrich

MISSION® esiRNA

targeting human EFEMP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTATGGGACCTTCCTGTGTCGCTGCCACCAGGGCTATGAGCTGCATCGGGATGGCTTCTCCTGCAGTGATATTGATGAGTGTAGCTACTCCAGCTACCTCTGTCAGTACCGCTGCATCAACGAGCCAGGCCGTTTCTCCTGCCACTGCCCACAGGGTTACCAGCTGCTGGCCACACGCCTCTGCCAAGACATTGATGAGTGTGAGTCTGGTGCGCACCAGTGCTCCGAGGCCCAAACCTGTGTCAACTTCCATGGGGGCTACCGCTGCGTGGACACCAACCGCTGCGTGGAGCCCTACATCCAGGTCTCTGAGAACCGCTGTCTCTGCCCGGCCTCCAACCCTCTATGTCGAGAGCAGCCTTCATCCATTGTGCACCGCTACATGACCATCACCTCGGA

Ensembl | nº de acceso humano

ENSG00000172638

Nº de acceso NCBI

NM_016938

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EFEMP2(30008) , EFEMP2(30008)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hao Liu et al.
Journal of biochemistry, 166(6), 495-502 (2019-08-10)
MicroRNAs (miRNAs) serve as key regulators in human disorders. Previous research reported that miR-211-5p is down-regulated in osteoarthritis (OA) and that Fibulin-4 inhibits chondrocyte differentiation. However, the role of miR-211-5p in the development of OA has not been clarified, and
Seung Jae Shin et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(8), 1905-1917 (2020-06-26)
Remodeling of the extracellular matrix plays a vital role in cardiovascular diseases. Using a mouse model of postnatal ascending aortic aneurysms (termed Fbln4SMKO), we have reported that abnormal mechanosensing led to aneurysm formation in Fbln4SMKO with an upregulation of the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico