Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052041

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCC2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGAAATTGCTGATCTCCTTTGCAAGTGACCGTGACACATATTTGTGGATTGGATATCTCTGTGCAATCCTCTTATTCACTGCGGCTCTCATTCAGTCTTTCTGCCTTCAGTGTTATTTCCAACTGTGCTTCAAGCTGGGTGTAAAAGTACGGACAGCTATCATGGCTTCTGTATATAAGAAGGCATTGACCCTATCCAACTTGGCCAGGAAGGAGTACACCGTTGGAGAAACAGTGAACCTGATGTCTGTGGATGCCCAGAAGCTCATGGATGTGACCAACTTCATGCACATGCTGTGGTCAAGTGTTCTACAGATTGTCTTATCTATCTTCTTCCTATGGAGAGAGTTGGGACCCTCAGTCTTAGCAGGTGTTGGGGTGATGGTGCTTGTAATCCCA

Ensembl | nº de acceso humano

ENSG00000023839

Nº de acceso NCBI

NM_000392

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ABCC2(1244) , ABCC2(1244)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Khine Myint et al.
Scientific reports, 9(1), 2245-2245 (2019-02-21)
Oxaliplatin is important for the clinical treatment of colorectal cancer and other gastrointestinal malignancies, but tumour resistance is limiting. Several oxaliplatin transporters were previously identified but their relative contributions to determining oxaliplatin tumour responses and gastrointestinal tumour cell sensitivity to
Andrés E Zucchetti et al.
Molecular biology of the cell, 22(20), 3902-3915 (2011-08-26)
In estradiol 17β-d-glucuronide (E17G)-induced cholestasis, the canalicular hepatocellular transporters bile salt export pump (Abcb11) and multidrug-resistance associated protein 2 (Abcc2) undergo endocytic internalization. cAMP stimulates the trafficking of transporter-containing vesicles to the apical membrane and is able to prevent internalization

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico