Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU051601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bo Ram Kim et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(12), 9475-9486 (2015-07-01)
Bone morphogenetic proteins (BMPs) have been involved in metastatic progression and tumorigenesis of many cancer types. However, it remains unclear how BMP-2 contributes to the initiation and development of these cancers. Here, we investigated the role of BMP-2 in colon
Dawid Wnuk et al.
Scientific reports, 10(1), 16492-16492 (2020-10-07)
Airway remodelling with subepithelial fibrosis, which abolishes the physiological functions of the bronchial wall, is a major issue in bronchial asthma. Human bronchial fibroblasts (HBFs) derived from patients diagnosed with asthma display in vitro predestination towards TGF-β1-induced fibroblast-to-myofibroblast transition (FMT)
X Su et al.
Cell death & disease, 6, e1851-e1851 (2015-08-08)
MicroRNAs (miRNAs) emerge as important regulators of stem cell lineage commitment and bone development. MiRNA-26a (miR-26a) is one of the important miRNAs regulating osteogenic differentiation of both bone marrow-derived mesenchymal stem cells (BMSCs) and adipose tissue-derived mesenchymal stem cells (ADSCs).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico