Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU049731

Sigma-Aldrich

MISSION® esiRNA

targeting human PDS5B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGCAACCTGGAACATCTCATAACACCATTGGTTACTATTGGTCATATTGCTCTCCTTGCACCTGATCAATTTGCTGCTCCTTTGAAATCTTTGGTAGCTACTTTCATTGTGAAAGATCTTCTCATGAATGATCGGCTTCCAGGGAAAAAGACAACTAAACTTTGGGTTCCAGATGAAGAAGTATCTCCTGAGACAATGGTCAAAATTCAGGCTATTAAAATGATGGTTCGATGGCTACTTGGAATGAAAAATAATCACAGTAAATCAGGAACTTCTACCTTAAGATTGCTAACAACAATATTGCATAGTGATGGAGACTTGACAGAACAGGGGAAAATTAGTAAACCAGATATGTCACGTCTGAGACTTGCTGCTGGGAGTGCTATTGTGAAGCTGGCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sujuan Xu et al.
Life sciences, 264, 118636-118636 (2020-11-06)
LncRNA HOXB-AS3 is proved as an oncogene in tumors. Herein, we determine the function and mechanism of HOXB-AS3 in epithelial ovarian cancer (EOC) cells. Chi-square test, Kaplan-Meier (KM) analysis and Cox regression analysis were used to analyze the clinicopathological features
Qifang Liu et al.
Infectious agents and cancer, 14, 37-37 (2019-12-14)
It has been reported that lncRNA MAGI2-AS3 can promote many types of cancer, such as breast cancer and bladder cancer, by regulating cell behaviors, such a proliferation, invasion, and migration. However, its role in cervical squamous cell carcinoma (CSCC) is
Gordana Wutz et al.
The EMBO journal, 36(24), 3573-3599 (2017-12-09)
Mammalian genomes are spatially organized into compartments, topologically associating domains (TADs), and loops to facilitate gene regulation and other chromosomal functions. How compartments, TADs, and loops are generated is unknown. It has been proposed that cohesin forms TADs and loops

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico