Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU049181

Sigma-Aldrich

MISSION® esiRNA

targeting human ZHX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAAACCAGACCGTGAAGAAATTGTAGAAAATCCAAGTTCTTCAGCTTCTGAATCTAATACAAGTACTTCCATTGTAAACAGAATACATCCAAGTACTGCCAGCACGGTAGTGACACCAGCAGCAGTTCTTCCTGGATTGGCACAGGTGATAACTGCTGTATCTGCTCAGCAGAATTCTAATTTGATTCCCAAAGTCTTAATCCCTGTTAATAGCATTCCCACCTACAATGCTGCATTGGATAACAATCCCCTTTTACTTAACACCTACAACAAGTTCCCTTACCCAACAATGTCAGAAATTACAGTTCTTTCTGCTCAAGCAAAATATACAGAGGAACAGATCAAGATATGGTTTTCAGCCCAACGTTTAAAACATGGTGTTAGTTGGACTCCCGAGGAAGT

Ensembl | nº de acceso humano

ENSG00000165156

Nº de acceso NCBI

NM_007222

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ZHX1(11244) , ZHX1(11244)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ryuk-Jun Kwon et al.
PloS one, 11(11), e0165516-e0165516 (2016-11-12)
Zinc-fingers and homeoboxes 1 (ZHX1) is a transcription repressor that has been associated with the progressions of hepatocellular carcinoma, gastric cancer, and breast cancer. However, the functional roles of ZHX1 in cholangiocarcinoma (CCA) have not been determined. We investigated the
Yi-Kai Pan et al.
Apoptosis : an international journal on programmed cell death, 25(1-2), 73-91 (2019-11-27)
Weightlessness-induced cardiovascular dysfunction can lead to physiological and pathological consequences. It has been shown that spaceflight or simulated microgravity can alter expression profiles of some microRNAs (miRNAs). Here, we attempt to identify the role of miRNAs in human umbilical vein
Jinping Guan et al.
American journal of translational research, 9(5), 2457-2465 (2017-06-01)
MicroRNAs play an important role in cell proliferation, apoptosis, differentiation, and invasion by regulating the expression of various genes. For example, the downregulation of microRNA-199a-3p (miR-199a-3p) that is noted in numerous human malignancies, including hepatocellular carcinoma (HCC), results in a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico