Saltar al contenido
Merck
Todas las fotos(2)

Documentos

EHU048671

Sigma-Aldrich

MISSION® esiRNA

targeting human CAT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(2)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTTCTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGATCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACTTTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACAGGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAGAAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTACCCTCTCATCCCAGTTGG

Ensembl | nº de acceso humano

ENSG00000121691

Nº de acceso NCBI

NM_001752

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CAT(847) , CAT(847)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mikko Konki et al.
Scientific reports, 6, 22190-22190 (2016-02-26)
Epigenomic regulation is likely to be important in the maintenance of genomic integrity of human pluripotent stem cells, however, the mechanisms are unknown. We explored the epigenomes and transcriptomes of human pluripotent stem cells before and after spontaneous transformation to
Lilibeth Lanceta et al.
PloS one, 10(8), e0134144-e0134144 (2015-08-14)
Earlier observations indicate that free heme is selectively toxic to cells lacking heme oxygenase-1 (HO-1) but how this enzyme prevents heme toxicity remains unexplained. Here, using A549 (human lung cancer) and immortalized human bronchial epithelial cells incubated with exogenous heme

Artículos

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico