Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU047961

Sigma-Aldrich

MISSION® esiRNA

targeting human GRK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAGGTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGACGTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTGGAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGGGGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAGTGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGCATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCT

Ensembl | nº de acceso humano

ENSG00000173020

Nº de acceso NCBI

NM_001619

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GRK2(156) , ADRBK1(156)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
NNU
TLU
AHU
QXT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xuezhi Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 110, 834-843 (2018-12-18)
CP-25 attenuates arthritis progression in animal models by inhibiting G protein-coupled receptor kinase 2 (GRK2) membrane expression. This study compared groups treated with high-dose methotrexate (MTX)/leflunomide (LEF) and CP-25 combined with low-dose MTX/LEF in an adjuvant-induced arthritis (AA) rat model
Xuezhi Yang et al.
Cells, 8(12) (2019-12-11)
Rheumatoid arthritis (RA) is characterized by the massive infiltration of various chronic inflammatory cells in synovia. In synovial fluid of patients with RA, M1 macrophages are dominant among all subtypes of macrophages, the mechanisms of macrophages polarization imbalance in RA
Jie Xu et al.
Nature communications, 8, 14002-14002 (2017-01-17)
β-TrCP and SKP2 are two well-studied F-box proteins, which often act as oncogenes. Whether and how they communicate with each other is unknown. Here we report that FBXW2, a poorly characterized F-box, is a substrate of β-TrCP1 and an E3
Jing Cheng et al.
The Journal of clinical investigation, 130(2), 1036-1051 (2020-01-22)
Antigen receptor-dependent (AgR-dependent) stimulation of the NF-κB transcription factor in lymphocytes is a required event during adaptive immune response, but dysregulated activation of this signaling pathway can lead to lymphoma. AgR stimulation promotes assembly of the CARMA1-BCL10-MALT1 complex, wherein MALT1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico