Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU047741

Sigma-Aldrich

MISSION® esiRNA

targeting human ROR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTCGACACCACAGACACAGGCTACTTCCAGTGCGTGGCAACAAACGGCAAGGAGGTGGTTTCTTCCACTGGAGTCTTGTTTGTCAAGTTTGGCCCCCCTCCCACTGCAAGTCCAGGATACTCAGATGAGTATGAAGAAGATGGATTCTGTCAGCCATACAGAGGGATTGCATGTGCAAGATTTATTGGCAACCGCACCGTCTATATGGAGTCTTTGCACATGCAAGGGGAAATAGAAAATCAGATCACAGCTGCCTTCACTATGATTGGCACTTCCAGTCACTTATCTGATAAGTGTTCTCAGTTCGCCATTCCTTCCCTGTGCCACTATGCCTTCCCGTACTGCGATGAAACTTCATCCGTCCCAAAGCCCCGTGACTTGTGTCGCGATGAATGTGAAAT

Ensembl | nº de acceso humano

ENSG00000185483

Nº de acceso NCBI

NM_001083592

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ROR1(4919) , ROR1(4919)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dongli Liu et al.
Scientific reports, 10(1), 13906-13906 (2020-08-19)
ROR1 and ROR2 are receptor tyrosine kinases with altered expression in a range of cancers. Silencing ROR1 or ROR2 in different tumour types has been shown to inhibit proliferation and decrease metastatic potential. The aim of this study was to
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico