Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU046951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARG2, VTI1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCAGAGGAAGAGGCGAAGACTACAGCTAACCTGGCAGTAGATGTGATTGCTTCAAGCTTTGGTCAGACAAGAGAAGGAGGGCATATTGTCTATGACCAACTTCCTACTCCCAGTTCACCAGATGAATCAGAAAATCAAGCACGTGTGAGAATTTAGGAGACACTGTGCACTGACATGTTTCACAACAGGCATTCCAGAATTATGAGGCATTGAGGGGATAGATGAATACTAAATGGTTGTCTGGGTCAATACTGCCTTAATGAGAACATTTACACATTCTCACAATTGTAAAGTTTCCCCTCTATTTTGGTGACCAATACTACTGTAAATGTATTTGGTTTTTTGCAGTTCACAGGGTATTAATATGCTACAGTACTATGTAAATTTAAAGAAGTCATAAACAGCATTTATTACCTTGGTATATCATACTGGTCTTGTTGCTGTTGTTCCTTCACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bon-Hyeock Koo et al.
Cells, 9(2) (2020-02-13)
Arginase II reciprocally regulates endothelial nitric oxide synthase (eNOS) through a p32-dependent Ca2+ control. We investigated the signaling pathway of arginase II-dependent eNOS phosphorylation. Western blot analysis was applied for examining protein activation and [Ca2+]c was analyzed by microscopic and
Kwanhoon Choi et al.
Molecular medicine reports, 22(3), 2395-2403 (2020-07-25)
The p32 protein plays a crucial role in the regulation of cytosolic Ca2+ concentrations ([Ca2+]c) that contributes to the Ca2+‑dependent signaling cascade. Using an adenovirus and plasmid p32‑overexpression system, the aim of the study was to evaluate the role of p32
Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico