Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU046331

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGACCAGTGTCAGGCAGGGGCCAGCCCCTCAGCCCCTGAGCCAAGGGGGAAAAGAAGAAAAAGTACCTAACACAAGCTTCCTTTTTGCACAACCGGTCCTCTTGGCTGAGGAGGAGGAGCTGGTCACCCTGGCTGCACAGTTAGAGAGGGGAGAAGGAACCCATGATGGGACTCCTGGGGTAGGGGCCAGGGGCTGGGGTCTGCTGGGGACAGGTCTCTCTGGGACAGACCTCAGAGATTGTGAATGCAGTGCCA

Ensembl | nº de acceso humano

ENSG00000161798

Nº de acceso NCBI

NM_001651

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AQP5(362) , AQP5(362)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Michihiro Kudou et al.
International journal of oncology, 50(5), 1857-1867 (2017-03-31)
Previous studies described that the expression of aquaporin 5 (AQP5) was altered in tumors of various organs. AQP5 is attracting attention as a new cancer therapeutic target. In the present study, heat shock-induced changes in AQP5 expression were evaluated by
Chen Chen et al.
Molecular carcinogenesis, 56(12), 2692-2705 (2017-08-24)
Epithelial-mesenchymal transition (EMT) has emerged as an important determinant role in colorectal cancer (CRC) metastasis. It has been reported that aquaporin 5 (AQP5) is closely linked to CRC metastasis. However, the effect of AQP5 on the EMT process of CRC
Xueqing Li et al.
OncoTargets and therapy, 11, 3359-3368 (2018-06-21)
Based on the functionality of AQP-5 characterized in various physiological processes, our study aimed to investigate the effect of AQP-5 silencing by siRNA interference on chemosensitivity of breast cancer cells. The expression levels of AQP-5 mRNA in different experimental groups
ChunXiao Yan et al.
Journal of ovarian research, 7, 78-78 (2014-10-10)
Recent studies suggested that aquaporins 5 (AQP5) was associated with many kinds of cancers and regulated many processes of various kinds of cancer cells. Our previous studies also demonstrated that AQP5 was highly expressed in epithelial ovarian cancer and contributed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico