Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU044751

Sigma-Aldrich

MISSION® esiRNA

targeting human MACC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAAGGTGATTTCAAAGGAGCAAGTAATGTTTATGTCAGATAGTGTCTTTACAACCAGAAATCTTCTTGAACAGATTGTCCTGCCTTTAAAAAAATTGACTTATATCTACTCAGTTGTATTAACCTTGGTGTCAGAAAAAGTTTATGATTGGAAAGTTTTAGCTGATGTCCTGGGTTACTCACATCTGTCCCTGGAAGATTTTGATCAAATTCAAGCAGACAAAGAATCAGAGAAAGTTTCTTATGTTATAAAGAAGTTAAAGGAAGATTGCCACACAGAGAGAAATACAAGGAAGTTTCTGTATGAACTTATTGTGGCTCTTCTGAAAATGGATTGCCAAGAGTTAGTCGCACGTCTCATCCAAGAAGCTGCTGTTCTGACTTCAGCTGTCAAGCTTGGAAAAGG

Ensembl | nº de acceso humano

ENSG00000183742

Nº de acceso NCBI

NM_182762

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MACC1(346389) , MACC1(346389)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiang Zhang et al.
Acta biochimica et biophysica Sinica, 50(8), 748-756 (2018-07-03)
One of the major obstacles hindering the treatment of lung cancer (LC) is chemoresistance; however, its mechanism remains unclear. The overexpression of the metastasis-associated in colon cancer 1 (MACC1) gene has been demonstrated to reverse chemoresistance. In the current study
Mingliang Lu et al.
Experimental and therapeutic medicine, 17(4), 2807-2814 (2019-03-25)
The mortality and incidence rates of colorectal cancer (CRC) vary widely worldwide. miR-338-3p inhibits tumor cell proliferation in several types of cancer, however, the role of miR-338-3p on CRC remains unknown. The aim of the current study was to investigate
C J Wei et al.
Neoplasma, 67(3), 537-546 (2020-02-18)
Gastric cardia adenocarcinoma (GCA) is one of the most common types of cancer and the incidence is increasing globally. MicroRNAs (miRNAs) have been reported to play critical roles in the progression of GCA. However, the exact role of miR-638 in
Yaoqing Li et al.
Molecular medicine reports, 12(1), 426-434 (2015-03-05)
Metastasis-associated in colon cancer-1 (MACC1) is a newly identified gene that is involved in the development and progression of hepatocellular carcinoma (HCC), however its investigation has not been comprehensive. In the present study, in vitro techniques, including immunohistochemistry, western blotting
Aiko Sueta et al.
International journal of oncology, 46(5), 2143-2153 (2015-03-05)
The newly identified gene, metastasis‑associated in colon cancer 1 (MACC1), is suggested to be a transcriptional regulator of c‑Met, leading to cancer progression in colorectal cancer. To date however, little is known of the role of MACC1 in breast cancer.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico