Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU044501

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53INP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGCCAACTAAAGACAAGGTTTTGAAATCTCAGCTATAAAAGACATCCAGCCAAACTCTCAGTCTTGCCTTAACAATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTCAATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAAGAAGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTACCGGCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATGGAGGAGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAAACAAGTCCTATGGAAAACCTTCTCATTGAACATCCCAGCA

Ensembl | nº de acceso humano

ENSG00000164938

Nº de acceso NCBI

NM_033285

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TP53INP1(94241) , TP53INP1(94241)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
RBV
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mingming Zhu et al.
Cancer medicine, 9(22), 8639-8649 (2020-09-29)
Recently, long noncoding RNAs (lncRNAs) were recognized as significant therapeutic targets in tumors. Our previous microarray analysis showed that lncRNA TCONS_000026334 expression was reduced in metastatic colorectal cancer (CRC) tissues. The objective of this study was to research the biological
Yonggang Huang et al.
Journal of Cancer, 11(22), 6545-6555 (2020-10-14)
Liver tumor-initiating cells (T-ICs) contribute to tumorigenesis, progression, recurrence and drug resistance of hepatocellular carcinoma (HCC). However, the underlying mechanism for the propagation of liver T-ICs remains unclear. In the present study, our finding shows that miR-96 is upregulated in
Xiaohuan Xia et al.
Stem cell research & therapy, 10(1), 282-282 (2019-09-25)
Recent studies suggested that miR-17~106 family was involved in the regulation of neural stem/progenitor cells (NPCs). However, distinct function of each family member was reported in regulating stem cells within and without the brain. Hence, to investigate the roles of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico