Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043821

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1CC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGGCCAAGATTCCACTGTTGGAGTGCCTAACCAGACATAGTTACAGAGAATGTTTGGGAAGACTGGATTCTTTACCTGAACATGAAGACTCAGAAAAAGCTGAGATGAAAAGATCCACTGAACTGGTGCTCTCTCCTGATATGCCTAGAACAACTAACGAATCTTTGTTAACCTCATTTCCCAAGTCAGTGGAACATGTGTCCCCAGATACCGCAGATGCTGAAAGTGGCAAAGAAATTAGGGAATCTTGTCAAAGTACTGTTCATCAGCAAGATGAAACTACGATTGACACTAAAGATGGTGATCTGCCCTTTTTTAATGTCTCTTTGTTAGACTGGATAAATGTTCAAGATAGACCTAATGATGTGGAATCTTTGGTCAGGAAGTGCTTTGATTCTATGAGCAGGCTTGATCCAAGGATTATTCGACCATTTATAGCAGAATGCCGTCAAACTATTGCC

Ensembl | nº de acceso humano

ENSG00000023287

Nº de acceso NCBI

NM_014781

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RB1CC1(9821) , RB1CC1(9821)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BUS
FBS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aykut Turan et al.
The Journal of cell biology, 218(2), 508-523 (2018-12-28)
Dendritic cells (DCs) are crucial for the induction of potent antiviral immune responses. In contrast to immature DCs (iDCs), mature DCs (mDCs) are not permissive for infection with herpes simplex virus type 1 (HSV-1). Here, we demonstrate that HSV-1 infection
Ingrid Kjos et al.
EMBO reports, 18(10), 1727-1739 (2017-08-25)
Autophagy (macroautophagy) is a highly conserved eukaryotic degradation pathway in which cytosolic components and organelles are sequestered by specialized autophagic membranes and degraded through the lysosomal system. The autophagic pathway maintains basal cellular homeostasis and helps cells adapt during stress;
Gaocai Li et al.
Cell death & disease, 11(2), 103-103 (2020-02-08)
N6 methyladenosine (m6A) is one of the most prevalent epitranscriptomic modifications of mRNAs, and plays a critical role in various bioprocesses. Bone-derived mesenchymal stem cells (BMSCs) can attenuate apoptosis of nucleus pulposus cells (NPCs) under compression; however, the underlying mechanisms
Eleonora Turco et al.
Molecular cell, 74(2), 330-346 (2019-03-12)
The autophagy cargo receptor p62 facilitates the condensation of misfolded, ubiquitin-positive proteins and their degradation by autophagy, but the molecular mechanism of p62 signaling to the core autophagy machinery is unclear. Here, we show that disordered residues 326-380 of p62
Qian Wang et al.
Free radical biology & medicine, 164, 369-380 (2021-01-16)
Metastasis is the major cause of death in women with advanced ovarian cancer. Epithelial ovarian cancer cells can dissociate directly from extracellular matrix (ECM) and form spheroids to spread through the peritoneal cavity. Loss of ECM hinders the survival of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico