Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU043091

Sigma-Aldrich

MISSION® esiRNA

targeting human ADM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGCACACCAGATCTACCAGTTCACAGATAAGGACAAGGACAACGTCGCCCCCAGGAGCAAGATCAGCCCCCAGGGCTACGGCCGCCGGCGCCGGCGCTCCCTGCCCGAGGCCGGCCCGGGTCGGACTCTGGTGTCTTCTAAGCCACAAGCACACGGGGCTCCAGCCCCCCCGAGTGGAAGTGCTCCCCACTTTCTTTAGGATTTAGGCGCCCATGGTACAAGGAATAGTCGCGCAAGCATCCCGCTGGTGCCTCCCGGGACGAAGGACTTCCCGAGCGGTGTGGGGACCGGGCTCTGACAGCCCTGCGGAGACCCTGAGTCCGGGAGGCACCGTCCGGCGGCGAGCTCTGGCTTTGCAAGGGCCCCTCCTTCTGGGGGCTTCGCTTCCTTAGCCTTGCTCAGGTGCAAGTGCCCCAGGGGGCGGGGTGCAGAAGAATCCGAGTGTTTGCCAGGCTTAAGGA

Ensembl | nº de acceso humano

ENSG00000148926

Nº de acceso NCBI

NM_001124

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ADM(133) , ADM(133)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carole-Anne Whigham et al.
Pregnancy hypertension, 16, 16-25 (2019-05-06)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and end-organ injury. Adrenomedullin (ADM) is a pro-angiogenic peptide hormone which regulates blood pressure and vascular integrity. It is highly expressed in both the
Lu Yao et al.
Archives of medical research, 50(1), 47-57 (2019-03-21)
Osteosarcoma is one of the most pernicious primary bone tumor characterized by high malignancy and metastasis, however its pathogenesis remain largely unknown. Our previous study showed elevated expression of adrenomedullin (ADM) is correlated with prognosis and disease severity in osteosarcoma
Shaojie Zhang et al.
Biochemical and biophysical research communications, 464(4), 1048-1053 (2015-07-22)
Bronchopulmonary dysplasia (BPD) is a chronic lung disease of premature infants that is characterized by alveolar simplification and decreased lung angiogenesis. Hyperoxia-induced oxidative stress and inflammation contributes to the development of BPD in premature infants. Adrenomedullin (AM) is an endogenous
Tiechui Zhu et al.
Molecular medicine reports, 11(5), 3760-3766 (2015-01-15)
Renal tubular epithelial cells can enter the epithelial‑to‑mesenchymal transition (EMT) in response to chronic hypoxia. EMT is a process which involves the phenotypic conversion of epithelial cells, that is believed to have an important role in renal fibrosis. However, the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico