Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU042381

Sigma-Aldrich

MISSION® esiRNA

targeting human MICALL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGGACATCCATGGAGAGATGGATACCATTGAGCGCCGGCTGGATGCCCTGGAGCACCGTGGGGTGCTGCTGGAGGAGAAGCTGCGTGGCGGCCTGAATGAGGGCCGTGAGGATGACATGCTGGTGGACTGGTTCAAGCTCATCCACGAGAAGCACCTACTGGTGCGGCGAGAGTCCGAGCTCATCTATGTCTTCAAGCAGCAGAACCTGGAGCAGCGCCAGGCTGATGTCGAGTATGAGCTCCGGTGCCTCCTCAATAAGCCAGAAAAGGACTGGACGGAGGAGGACCGGGCCCGGGAGAAGGTGCTGATGCAGGAGCTTGTGACCCTCATTGAGCAGCGCAACGCTATCATCAACTGCCTGGATGAGGACCGGCAGAGGGAGGAAGAGGAAGACAAGATGTTGGAAGCCATGATCAAGAAGAAAGAGTTCCAGAGGGAGGCTGAACCTGAGGGCAAGAAG

Ensembl | nº de acceso humano

ENSG00000100139

Nº de acceso NCBI

NM_033386

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MICALL1(85377) , MICALL1(85377)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Zhang et al.
Frontiers in cell and developmental biology, 9, 644716-644716 (2021-04-02)
Hepatocellular carcinoma (HCC) is one of the malignant tumors with poor prognosis. High expression level of cofilin 1 (CFL1) has been found in many types of cancers. However, the role of CFL1 in HCC hasn't been known clearly. Here, we
Ning Li et al.
Developmental and comparative immunology, 106, 103599-103599 (2020-01-04)
ATP-dependent DEAD (Asp-Glu-Ala-Asp)-box RNA helicases not only regulate RNA metabolism, but also are involved in host antiviral innate immune responses. It is important to investigate the orthologs of this protein family to broaden our understanding of innate immunity and promote

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico