Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU042121

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL13

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCTGCTTCTCATGCTGCTGGTCAGCAGCCTCTCTCCAGTCCAAGGTGTTCTGGAGGTCTATTACACAAGCTTGAGGTGTAGATGTGTCCAAGAGAGCTCAGTCTTTATCCCTAGACGCTTCATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAGAAGAACAAGTCAATTGTGTGTGTGGACCCTCAAGCTGAATGGATACAAAGAATGATGGAAGTATTGAGAAAAAGAAGTTCTTCAACTCTACCAGTTCCAGTGTTTAAGAGAAAGATTCCCTGATGCTGATATTTCCACTAAGAACACCTGCATTCTTCCCTTATCCCTGCTCTGGATTTTAGTTTTGTGCTTAGTTAAATCTTTTCCAGGAAAAAGAACTTCCCCATACAAATAAGCATGAGACTATGTAAAAATAACCTTGCAGAAGCTGATGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yanan Shen et al.
Journal of neuroinflammation, 17(1), 335-335 (2020-11-10)
Perioperative neurocognitive disorders (PNDs) occur frequently after surgery and worsen patient outcome. How C-X-C motif chemokine (CXCL) 13 and its sole receptor CXCR5 contribute to PNDs remains poorly understood. A PND model was created in adult male C57BL/6J and CXCR5-/-
Hui Zhang et al.
Thoracic cancer, 6(2), 172-179 (2015-08-15)
To determine the relationship between FOXN1 (a transcription factor) and B cell-attracting chemokine 1 (BCA1, a chemotactic factor), and their influence on thymoma cell proliferation. We initially used immunohistochemical methods to compare the expression levels of FOXN1 and BCA1 in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico