Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU041851

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTCCTCCTTCTCCTCTCCTTCCAGCGCGGGAAGGCATGTGCGGAGCTACAATCACCTTCAAGGAGATGTCCGCTGGAGAAAGCTATTCTCTTTCACCAAGTACTTTCTCAAGATTGAGAAGAACGGGAAGGTCAGCGGGACCAAGAAGGAGAACTGCCCGTACAGCATCCTGGAGATAACATCAGTAGAAATCGGAGTTGTTGCCGTCAAAGCCATTAACAGCAACTATTACTTAGCCATGAACAAGAAGGGGAAACTCTATGGCTCAAAAGAATTTAACAATGACTGTAAGCTGAAGGAGAGGATAGAGGAAAATGGATACAATACCTATGCATCATTTAACTGGCAGCATAATGGGAGGCAAATGTATGTGGCATTGAATGGAAAAGGAGCTCCAAGGAGAGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Santie Li et al.
Redox biology, 40, 101859-101859 (2021-01-15)
Hepatic ischemia-reperfusion injury (IRI) is a major complication of liver surgery and transplantation. IRI leads to hepatic parenchymal cell death, resulting in liver failure, and lacks effective therapeutic approaches. Fibroblast growth factor 10 (FGF10) is a paracrine factor which is
Zhiling Yan et al.
International journal of molecular medicine, 34(5), 1301-1308 (2014-09-02)
Syndecan-4 (SDC4), a transmembrane heparan sulfate proteoglycan, acts as a signal transducer. It affects the growth and differentiation of a number of tissues and organs. However, the specific mechanisms through which SDC4 regulates the differentiation of dental epithelial cells (amelogenesis)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico