Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU041431

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGACTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGATTTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTACAAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAAATGTTCTTAAGCAAATATATACCTATTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGAACTCAAAGACACG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Yang et al.
IUBMB life, 67(3), 182-190 (2015-04-11)
Emerging evidence indicates that the water channel protein aquaporin 4 (AQP4) plays an essential role in water homeostasis and is implicated in the pathogenesis of brain edema. This study aimed to understand the physiological role of AQP4 in hypoxia-ischemia-mediated cytotoxic
Letizia Granieri et al.
PloS one, 7(6), e38896-e38896 (2012-06-22)
Neuromyelitis optica (NMO) is a severely disabling autoimmune disorder of the central nervous system, which predominantly affects the optic nerves and spinal cord. In a majority of cases, NMO is associated with antibodies to aquaporin-4 (AQP4) (termed NMO-IgG). In this
Yusi Cheng et al.
Clinical and experimental pharmacology & physiology, 44(11), 1106-1115 (2017-07-09)
Aquaporin 4 (AQP4) is a type of water channel protein that maintains the water balance of cardiomyocytes. However, the physiological role of AQP4 in cardiovascular disease is poorly understood. We wanted to explore whether p66Shc and endoplasmic reticulum stress participates
Jing Jin et al.
European neurology, 83(6), 581-590 (2020-11-02)
Stroke is one of the leading causes of mortality and disability worldwide. Long noncoding RNAs (lncRNAs) including MALAT1 have been shown to have critical roles in cerebral ischemia reperfusion injury (CIRI). However, the underlying mechanism of MALAT1 in CIRI has
Dongfeng Niu et al.
PloS one, 7(7), e40770-e40770 (2012-07-19)
Aquaporin3 (AQP3) and Aquaporin4 (AQP4) play a major role in transcellular and transepithelial water movement as water channel membrane proteins. Little is known of their expression and significance in human thyroid tissues. Thus, we examined the expression of AQP3 and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico