Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU041011

Sigma-Aldrich

MISSION® esiRNA

targeting human HPSE

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGCAGCTGGCTTTATGTGGCTGGATAAATTGGGCCTGTCAGCCCGAATGGGAATAGAAGTGGTGATGAGGCAAGTATTCTTTGGAGCAGGAAACTACCATTTAGTGGATGAAAACTTCGATCCTTTACCTGATTATTGGCTATCTCTTCTGTTCAAGAAATTGGTGGGCACCAAGGTGTTAATGGCAAGCGTGCAAGGTTCAAAGAGAAGGAAGCTTCGAGTATACCTTCATTGCACAAACACTGACAATCCAAGGTATAAAGAAGGAGATTTAACTCTGTATGCCATAAACCTCCATAATGTCACCAAGTACTTGCGGTTACCCTATCCTTTTTCTAACAAGCAAGTGGATAAATACCTTCTAAGACCTTTGGGACCTCATGGATTACTTTCCAAATCTGTCCAACTCAATGGTCTAACTCTAAAGATGGTGGATGATCAAACCTTGCCACCTTTAATGGAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Marjolein Garsen et al.
The American journal of pathology, 186(4), 805-815 (2016-02-14)
Heparanase, a heparan sulfate (HS)--specific endoglucuronidase, mediates the onset of proteinuria and renal damage during experimental diabetic nephropathy. Glomerular heparanase expression is increased in most proteinuric diseases. Herein, we evaluated the role of heparanase in two models of experimental glomerulonephritis
Jianping Li et al.
American journal of cancer research, 7(2), 234-244 (2017-03-25)
Heparanase (HPSE1) is elevated in various types of cancers including cervical cancer, and correlated with poor prognosis. Current study is to investigate the effects of HPSE1 on radiation response in cervical cancer. Colony formation assays after radiation were performed to
Uri Barash et al.
International journal of cancer, 145(6), 1596-1608 (2019-04-30)
Heparanase is an endo-β-d-glucuronidase that cleaves heparan sulfate (HS) side chains of heparan sulfate proteoglycans. Compelling evidence tie heparanase levels with all steps of tumor formation including tumor initiation, growth, metastasis and chemo-resistance, likely involving augmentation of signaling pathways and
Haiyan Zheng et al.
Cancer biomarkers : section A of Disease markers, 15(5), 525-534 (2015-01-15)
Heparanase(HPSE), an endo-β -D-glucuronidase, is found overexpressed in Ovarian cancer (OC). The purpose of our work was to investigate primitively the possible role of HPSE in the development of OC. In this study, RNA interference (RNAi) with a HPSE small
Satvik R Hadigal et al.
Nature communications, 6, 6985-6985 (2015-04-29)
Herpesviruses exemplified by herpes simplex virus-1 (HSV-1) attach to cell surface heparan sulfate (HS) for entry into host cells. However, during a productive infection, the HS moieties on parent cells can trap newly exiting viral progenies and inhibit their release.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico