Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU040601

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTTCAGCTCTCCATTGCTTTCTATAATCCAGACCTTCAGCATGATGCTAGGAGATATCAATTATCGAGAGTCCTTCCTAGAACCATATCTGAGAAATGAATTGGCACATCCAGTTCTGTCCTTTGCACAACTTGTTTCCTTCACAATATTTGTCCCAATTGTCCTCATGAATTTACTTATTGGTTTGGCAGTTGGCGACATTGCTGAGGTCCAGAAACATGCATCATTGAAGAGGATAGCTATGCAGGTGGAACTTCATACCAGCTTAGAGAAGAAGCTGCCACTTTGGTTTCTACGCAAAGTGGATCAGAAATCCACCATCGTGTATCCCAACAAACCCAGATCTGGTGGGATGTTATTCCATATATTCTGTTTTTTATTTTGCACTGGGGAAATAAGACAAGAAATACCAAATGCTGATAAATCTTTAGAAATGGAAATATTAAAGCAGAAATACCGGCTGA

Ensembl | nº de acceso humano

ENSG00000104321

Nº de acceso NCBI

NM_007332

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TRPA1(8989) , TRPA1(8989)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fabio Arturo Iannotti et al.
British journal of pharmacology, 176(10), 1568-1584 (2018-08-04)
Duchenne muscular dystrophy (DMD), caused by dystrophin deficiency, results in chronic inflammation and irreversible skeletal muscle degeneration. Moreover, the associated impairment of autophagy greatly contributes to the aggravation of muscle damage. We explored the possibility of using non-euphoric compounds present
Florentina Cojocaru et al.
Scientific reports, 11(1), 2018-2018 (2021-01-23)
The transient receptor potential ankyrin type 1 (TRPA1) channel belongs to the TRP superfamily of ion channels. TRPA1 is a membrane protein with multiple functions able to respond to noxious stimuli, reactive oxygen species, inflammatory cytokines or pungent substances, and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico