Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU036201

Sigma-Aldrich

MISSION® esiRNA

targeting human CD80

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGCACAAACTCGCATCTACTGGCAAAAGGAGAAGAAAATGGTGCTGACTATGATGTCTGGGGACATGAATATATGGCCCGAGTACAAGAACCGGACCATCTTTGATATCACTAATAACCTCTCCATTGTGATCCTGGCTCTGCGCCCATCTGACGAGGGCACATACGAGTGTGTTGTTCTGAAGTATGAAAAAGACGCTTTCAAGCGGGAACACCTGGCTGAAGTGACGTTATCAGTCAAAGCTGACTTCCCTACACCTAGTATATCTGACTTTGAAATTCCAACTTCTAATATTAGAAGGATAATTTGCTCAACCTCTGGAGGTTTTCCAGAGCCTCACCTCTCCTGGTTGGAAAATGGAGAAGAATTAAATGCCATCAACACAACAGTTTCCCAAGATCCTGAAACTGAGCTCTATGCTGTTAGCAGCAAACTGGATTTCAATATGACAACCAACCACAGCTTCATG

Ensembl | nº de acceso humano

ENSG00000121594

Nº de acceso NCBI

NM_005191

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD80(941) , CD80(941)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chenxia Juan et al.
The international journal of biochemistry & cell biology, 104, 138-148 (2018-09-24)
Neonatal respiratory distress syndrome (NRDS) is a leading cause of morbidity in premature newborns and is a common reason for admission to the neonatal intensive care unit (NICU). Recent studies found that the pathogenesis of NRDS is not simply lung
Yuxuan Miao et al.
Cell, 177(5), 1172-1186 (2019-04-30)
Our bodies are equipped with powerful immune surveillance to clear cancerous cells as they emerge. How tumor-initiating stem cells (tSCs) that form and propagate cancers equip themselves to overcome this barrier remains poorly understood. To tackle this problem, we designed
Xusheng Zhang et al.
Journal of translational medicine, 12, 142-142 (2014-06-03)
While substantial progress has been made in blocking acute transplant rejection with the advent of immune suppressive drugs, chronic rejection, mediated primarily by recipient antigen presentation, remains a formidable problem in clinical transplantation. We hypothesized that blocking co-stimulatory pathways in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico