Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU035401

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL16

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGCTTACTCGGGGATTGTGGCCCACCAGAAGCATTTACTTCCTACCAGCCCCCCAATTTCTCAGGCCTCAGAGGGGGCATCTTCAGATATCCACACCCCTGCCCAGATGCTCCTGTCCACCTTGCAGTCCACTCAGCGCCCCACCCTCCCAGTAGGATCACTGTCCTCGGACAAAGAGCTCACTCGTCCCAATGAAACCACCATTCACACTGCGGGCCACAGTCTGGCAGCTGGGCCTGAGGCTGGGGAGAACCAGAAGCAGCCGGAAAAAAATGCTGGTCCCACAGCCAGGACATCAGCCACAGTGCCAGTCCTGTGCCTCCTGGCCATCATCTTCATCCTCACCGCAGCCCTTTCCTATGTGCTGTGCAAGAGGAGGAGGGGGCAGTCACCGCAGTCCTCTCCAGATCTGCCGGTTCATTATATACCTGTGGCACCTGACTCTAATACCTGAGCCAAGAATGGAAGCTT

Ensembl | nº de acceso humano

ENSG00000161921

Nº de acceso NCBI

NM_022059

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CXCL16(58191) , CXCL16(58191)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhenzhen Ma et al.
Respiratory research, 22(1), 42-42 (2021-02-08)
Alveolar epithelial cells play an essential role in the initiation and progression of pulmonary fibrosis, and the occurrence of epithelial-mesenchymal transition (EMT) may be the early events of pulmonary fibrosis. Recent studies have shown chemokines are involved in the complex
Kun Ling Ma et al.
American journal of translational research, 10(6), 1802-1816 (2018-07-19)
Non-alcoholic fatty liver disease (NAFLD), characterised by early lipid accumulation and subsequent inflammation in the liver, is becoming a worldwide challenge due to its increasing prevalence in developing and developed countries. This study aimed to investigate the role of CXC
Audrey Dieudonné et al.
PloS one, 7(8), e41952-e41952 (2012-08-11)
Scavenger receptors and Toll-like receptors (TLRs) cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (ds)RNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed
Ze-Bo Hu et al.
Acta pharmacologica Sinica, 39(6), 1022-1033 (2018-04-06)
Inflammation and lipid disorders play crucial roles in synergistically accelerating the progression of diabetic nephropathy (DN). In this study we investigated how inflammation and lipid disorders caused tubulointerstitial injury in DN in vivo and in vitro. Diabetic db/db mice were
Yijie Zhang et al.
Pathology, research and practice, 216(5), 152913-152913 (2020-03-17)
CXC chemokine ligand 16 (CXCL16) has been reported to exacerbate acute kidney injury induced by ischemia-reperfusion (IR). This study aimed to investigate the probable role of CXCL16 in hepatic IR injury during liver transplantation. The expression patterns of CXCL16 and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico