Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU035001

Sigma-Aldrich

MISSION® esiRNA

targeting human BDKRB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGTTGTGCTGCTGCTATTCATCATCTGCTGGCTGCCCTTCCAGATCAGCACCTTCCTGGATACGCTGCATCGCCTCGGCATCCTCTCCAGCTGCCAGGACGAGCGCATCATCGATGTAATCACACAGATCGCCTCCTTCATGGCCTACAGCAACAGCTGCCTCAACCCACTGGTGTACGTGATCGTGGGCAAGCGCTTCCGAAAGAAGTCTTGGGAGGTGTACCAGGGAGTGTGCCAGAAAGGGGGCTGCAGGTCAGAACCCATTCAGATGGAGAACTCCATGGGCACACTGCGGACCTCCATCTCCGTGGAACGCCAGATTCACAAACTGCAGGACTGGGCAGGGAGCAGACAGTGAGCAAACGCCAGCAGGGCTGCTGTGAATTTGTGTAAGGATTGAGGGACAGTTGCTTTTCAGCATGGGCCCAGGAATGCCAAGGAGACATCTATGCACGACCTTGGGAAATGAGT

Ensembl | nº de acceso humano

ENSG00000168398

Nº de acceso NCBI

NM_000623

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BDKRB2(624) , BDKRB2(624)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guojun Wang et al.
Journal of cellular biochemistry, 118(12), 4444-4453 (2017-05-04)
Bradykinin (BK) has been reported to be involved in the progression of diverse types of cancer. In the present study, we investigated the possible role of BK in cell proliferation, migration, invasion, and tumor growth of gastric cancer (GC). Cell
Yih-Jeng Tsai et al.
PloS one, 10(5), e0126853-e0126853 (2015-05-15)
Chronic rhinosinusitis (CRS) is a chronic inflammatory disease of the sinonasal mucosa either accompanied by polyp formation (CRSwNP) or without polyps (CRSsNP). CRSsNP accounts for the majority of CRS cases and is characterized by fibrosis and neutrophilic inflammation. However, the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico