Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034751

Sigma-Aldrich

MISSION® esiRNA

targeting human XPO1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAACTAAAGCAGATGCTTCCTTTAAATACCAATATTCGACTTGCGTACTCAAATGGAAAAGATGATGAACAGAACTTCATTCAAAATCTCAGTTTGTTTCTCTGCACCTTTCTTAAGGAACATGATCAACTTATAGAAAAAAGATTAAATCTCAGGGAAACTCTTATGGAGGCCCTTCATTATATGTTGTTGGTATCTGAAGTAGAAGAAACTGAAATCTTTAAAATTTGTCTTGAATACTGGAATCATTTGGCTGCTGAACTCTATAGAGAGAGTCCATTCTCTACATCTGCCTCTCCGTTGCTTTCTGGAAGTCAACATTTTGATGTTCCTCCCAGGAGACAGCTATATTTGCCCATGTTATTCAAGGTCCGTTTATTAATGGTTAGTCGAATGGCTAAACCAGAGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Asfar S Azmi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(6), 1338-1348 (2019-12-14)
Pancreatic ductal adenocarcinoma (PDAC) remains a deadly disease urgently requiring new treatments. Overexpression of the protein transporter exportin-1 (XPO1) leads to mislocalization of tumor-suppressor proteins (TSP) and their inactivation. Earlier, we showed that blocking XPO1 by CRISPR/Cas9 validated Selective Inhibitor
Xiaojing Yang et al.
Medical oncology (Northwood, London, England), 31(9), 155-155 (2014-08-26)
Chromosome region maintenance 1 (CRM1) has been related to several malignancies. The predictive value of CRM1 in the malignance and prognosis of esophageal squamous cell carcinoma (ESCC), however, is not clear yet. In this study, we displayed that CRM1 expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico