Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU034611

Sigma-Aldrich

MISSION® esiRNA

targeting human H19

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCACCTTGGACATCTGGAGTCTGGCAGGGTTTGATCCCAGGGCCTGGGCAACGGAGGTGTAGCTGGCAGCAGCGGGCAGGTGAGGACCCCATCTGCCGGGCAGGTGAGTCCCTTCCCTCCCCAGGCCTCGCTTCCCCAGCCTTCTGAAAGAAGGAGGTTTAGGGGATCGAGGGCTGGCGGGGAGAAGCAGACACCCTCCCAGCAGAGGGGCAGGATGGGGGCAGGAGAGTTAGCAAAGGTGACATCTTCTCGGGGGGAGCCGAGACTGCGCAAGGCTGGGGGGTTATGGGCCCGTTCCAGGCAGAAAGAGCAAGAGGGCAGGGAGGGAGCACAGGGGTGGCCAGCGTAGGGTCCAGCACGTGGGGTGGTACCCCAGGCCTGGGTCAGACAGGGACATGGCAGGGGACACAGGACAGAGGGGTCCCCAGCTGCCACCTCACCCACCGCAATTCATTTAGTAGCAGGCACAGGGG

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... H19(10188)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Vinay Shivanna et al.
Virology, 483, 218-228 (2015-05-20)
Our recent results demonstrated that bile acids facilitate virus escape from the endosomes into the cytoplasm for successful replication of porcine enteric calicivirus (PEC). We report a novel finding that bile acids can be substituted by cold treatment for endosomal
A Bai et al.
Cell death & disease, 6, e1828-e1828 (2015-07-24)
Acid sphingomyelinase (ASM), a lipid hydrolase enzyme, has the potential to modulate various cellular activation responses via the generation of ceramide and by interaction with cellular receptors. We have hypothesized that ASM modulates CD4(+) T-cell receptor activation and impacts immune

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico