Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034581

Sigma-Aldrich

MISSION® esiRNA

targeting human GOLPH3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCAACAGGGGATGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAAACTCAGCCTCCAGAAACGGTCCAGAACTGGATTGAATTACTTAGTGGTGAGACATGGAATCCATTAAAATTGCATTATCAGTTAAGAAATGTACGGGAACGATTAGCTAAAAACCTGGTGGAAAAGGGTGTATTGACAACAGAGAAACAGAACTTCCTACTTTTTGACATGACAACACATCCCCTCACCAATAACAACATTAAGCAGCGCCTCATCAAGAAAGTACAGGAAGCCGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAGGCGCTTGCTGGCCCTCATTTACCTGGCTCATGCCTCGGACGTCCTGGAGAATGCTTTTGCTCCTCTTCTGGACGAGCAGTATGATTTGGCTACCAAGAGAGTGCGGCAGCTTCTCGACTTAGACCCTGAAGTGGAATGTCTGAAGGCCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dong Lu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 47(6), 2445-2457 (2018-07-11)
Golgi phosphoprotein 3 (GOLPH3) plays pro-malignancy roles in several types of cancer. However, the molecular mechanism underlying GOLPH3 promoting tumor progression remains poorly understood. The expression of GOLPH3 and Wntless (Wls) in glioma tissues was examined by western blotting and
Tao Yu et al.
Life sciences, 260, 118294-118294 (2020-08-21)
To explore whether GOLPH3 regulated oxaliplatin (L-OHP) resistance of colon cancer cells via PI3K/AKT/mTOR pathway. HCT116/L-OHP cells were divided into Blank, Control/GOLPH3 shRNA, BEZ235 (a PI3K/AKT/mTOR inhibitor), and GOLPH3 + BEZ235 groups followed by the detection with MTT, soft agar colony formation
Qian Li et al.
Molecular medicine reports, 11(6), 4315-4320 (2015-01-31)
Golgi phosphoprotein 3 (GOLPH3) overexpression has previously been associated with the progression of several solid tumors, which resulted in adverse clinical outcomes. The present study aimed to determine the expression and prognostic significance of GOLPH3 in human hepatocellular carcinoma (HCC). GOLPH3

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico