Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU031571

Sigma-Aldrich

MISSION® esiRNA

targeting human APOBEC3A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGGACACAGACCAGGAACCGAGAAGGGACAAGCACATGGAAGCCAGCCCAGCATCCGGGCCCAGACACTTGATGGATCCACACATATTCACTTCCAACTTTAACAATGGCATTGGAAGGCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGACAATGGCACCTCGGTCAAGATGGACCAGCACAGGGGCTTTCTACACAACCAGGCTAAGAATCTTCTCTGTGGCTTTTACGGCCGCCATGCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCCCAGATCTACAGGGTCACTTGGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAACACACACGTGAGACTGCGTATCTTCG

Ensembl | nº de acceso humano

ENSG00000128383

Nº de acceso NCBI

NM_145699

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... APOBEC3A(100913187) , APOBEC3A(200315)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Emad Y Alqassim et al.
Communications biology, 4(1), 102-102 (2021-01-24)
Pro-inflammatory M1 macrophage polarization is associated with microbicidal and antitumor responses. We recently described APOBEC3A-mediated cytosine-to-uracil (C > U) RNA editing during M1 polarization. However, the functional significance of this editing is unknown. Here we find that APOBEC3A-mediated cellular RNA editing can
Yang Yang et al.
The Journal of investigative dermatology, 137(4), 810-818 (2016-11-29)
Apolipoprotein B mRNA-editing catalytic polypeptide (APOBEC) 3 proteins have been identified as potent viral DNA mutators and have broad antiviral activity. In this study, we demonstrated that apolipoprotein B mRNA-editing catalytic polypeptide 3A (A3A) and A3G expression levels were significantly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico