Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU028201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFA13

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTCTGGGCAAAAGAGGAGTAAAGACCCCTCAGCTGCAGCCCGGCAGCGCATTCCTACCCAGGGTCCGCCGCCAGAGCTTTCCCGCGCGGTCGGATAGTTACACTACTGTCCGGGACTTCCTAGCCGTGCCGCGGACCATCTCAAGTGCTTCCGCCACACTCATCATGGCGGTGGCAGTAAGTCACTTCCGCCCGGGACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTATGGGCCCATCGACTACAAACGGAACTTGCCGCGTCGAGGACTGTCGGGCTACAGCATGCTGGCCATAGGGATTGGAACCCTGATCTACGGGCACTGGAGCATAATGAAGTGGAACCGTGAGCGCAGGCGCCTACAAATCGAGGACTTCGAGGCTCGCATCGCGCTGTTGCCACTGTTACAGGCAGAAACCGACCGGAGGACCTTGCAGATGCTTC

Ensembl | nº de acceso humano

ENSG00000130288

Nº de acceso NCBI

NM_015965

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NDUFA13(51079) , NDUFA13(51079)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JTR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Huang et al.
Oncotarget, 7(27), 41404-41420 (2016-05-12)
Aberrant STAT3 activation occurs in most human gastric cancers (GCs) and contributes to the malignant progression of GC, but mechanism(s) underlying aberrant STAT3 remain largely unknown. Here we demonstrated that the gene associated with retinoid interferon-induced mortality 19 (GRIM-19) was
Jung-Hee Kim et al.
Frontiers in microbiology, 8, 576-576 (2017-04-27)
Gene-associated with retinoid-interferon-induced mortality 19 (GRIM-19) targets multiple signaling pathways involved in cell death and growth. However, the role of GRIM-19 in the pathogenesis of hepatitis virus infections remains unexplored. Here, we investigated the restrictive effects of GRIM-19 on the
JooYeon Jhun et al.
Cells, 10(1) (2021-01-21)
Obesity, a condition characterized by excessive accumulation of body fat, is a metabolic disorder related to an increased risk of chronic inflammation. Obesity is mediated by signal transducer and activator of transcription (STAT) 3, which is regulated by genes associated
Ping Cui et al.
Cellular signalling, 71, 109598-109598 (2020-03-14)
Recent evidence has demonstrated that the signal transducer and activator of transcription 3 (STAT3) gene are abnormally active in glioblastoma multiforme (GBM), and this change is crucial for the tumor survival and chemotherapy-resistant. Certain preclinical pharmacology studies have focused on
Na Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1169-1176 (2017-09-21)
The gene associated with retinoid-interferon-induced mortality-19 (GRIM-19) has been identified as a tumor suppressor in many human cancers. However, little is known about the role of GRIM-19 in cutaneous squamous cell carcinoma (CSCC). Here, we aimed to investigate the potential
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico