Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU026711

Sigma-Aldrich

MISSION® esiRNA

targeting human CEP192

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TATTTGTGCAGCCATTTGGACCTCAGTATGAGGTAGTGTTAAAAGGCGAAGTCATTTCTTCAGGAAGTAAACCTCTGTCACCTGGACCTTGCTTAGATATTCCATCGATTTTGTCCAACAAACAATTTCTGGCTTGGGGAGGAGTCCCTCTAGGTAGAACACAGCTTCAGAAACTAGCTTTAAGAAATAATTCTGCATCTACAACTCAACATTTACGACTGCTTATTAGAGGACAAGATCAGGACTGCTTTCAGCTTCAGAACACTTTTGGTTCAGAACAGCGATTGACCAGTAACTGTGAGATCAGAATTCACCCAAAGGAAGACATTTTCATCTCTGTATTATTTGCACCTACTCGATTATCTTGCATGTTGGCTAGACTAGAAATCAAACAACTTGGAAATCGATCACAACCAGG

Ensembl | nº de acceso humano

ENSG00000101639

Nº de acceso NCBI

NM_032142

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CEP192(55125) , CEP192(55125)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Franz Meitinger et al.
Nature, 585(7825), 440-446 (2020-09-11)
Centrosomes catalyse the formation of microtubules needed to assemble the mitotic spindle apparatus1. Centrosomes themselves duplicate once per cell cycle, in a process that is controlled by the serine/threonine protein kinase PLK4 (refs. 2,3). When PLK4 is chemically inhibited, cell
Wangfei Chi et al.
The Journal of cell biology, 220(1) (2020-12-23)
Centrosome duplication occurs under strict spatiotemporal regulation once per cell cycle, and it begins with cartwheel assembly and daughter centriole biogenesis at the lateral sites of the mother centrioles. However, although much of this process is understood, how centrosome duplication

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico