Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU026451

Sigma-Aldrich

MISSION® esiRNA

targeting human ORMDL3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGAGAGTGCAGCCCCTT

Ensembl | nº de acceso humano

ENSG00000172057

Nº de acceso NCBI

NM_139280

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ORMDL3(94103) , ORMDL3(94103)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weixia Yang et al.
Aging, 11(9), 2787-2796 (2019-05-08)
Endoplasmic reticulum (ER) stress in beta cells induces a signaling network called the unfolded protein response (UPR), which plays a dual role in diabetes. A key regulator of ER-stress and UPR, the orosomucoid 1-like protein 3 (ORMDL3), has been shown
Youming Zhang et al.
American journal of respiratory and critical care medicine, 199(4), 478-488 (2018-10-20)
Polymorphisms on chromosome 17q21 confer the major genetic susceptibility to childhood-onset asthma. Risk alleles positively correlate with ORMDL3 (orosomucoid-like 3) expression. The locus influences disease severity and the frequency of human rhinovirus (HRV)-initiated exacerbations. ORMDL3 is known to regulate sphingolipid
Yiping Liu et al.
American journal of respiratory cell and molecular biology, 62(6), 783-792 (2020-02-23)
Polymorphism at the 17q21 gene locus and wheezing responses to rhinovirus (RV) early in childhood conspire to increase the risk of developing asthma. However, the mechanisms mediating this gene-environment interaction remain unclear. In this study, we investigated the impact of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico