Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU024991

Sigma-Aldrich

MISSION® esiRNA

targeting human ADRM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGGAAAGATGTCCCTGAAGGGGACCACCGTGACTCCGGATAAGCGGAAAGGGCTGGTGTACATTCAGCAGACGGACGACTCGCTTATTCACTTCTGCTGGAAGGACAGGACGTCCGGGAACGTGGAAGACGACTTGATCATCTTCCCTGACGACTGTGAGTTCAAGCGGGTGCCGCAGTGCCCCAGCGGGAGGGTCTACGTGCTGAAGTTCAAGGCAGGGTCCAAGCGGCTTTTCTTCTGGATGCAGGAACCCAAGACAGACCAGGATGAGGAGCATTGCCGGAAAGTCAACGAGTATCTGAACAACCCCCCGATGCCTGGGGCGCTGGGGGCCAGCGGAAGCAGCGGCCACGAACTCTCTGCGCTAGGCGGTGAGGGTGGCCTGCAGAGCCTGCTGGGAAACATGAGCCACAGCCAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Marlena S Fejzo et al.
International journal of molecular sciences, 14(2), 3094-3109 (2013-02-05)
Approximately 25,000 ovarian cancers are diagnosed in the U.S. annually, and 75% are in the advanced stage and largely incurable. There is critical need for early detection tools and novel treatments. Proteasomal ubiquitin receptor ADRM1 is a protein that is
Yiping Huang et al.
Aging, 2(12), 959-968 (2010-12-31)
Oxidative stress was shown to promote the translocation of Ataxia-telangiectasia mutated (ATM) to cytoplasm and trigger the LKB1-AMPK-tuberin pathway leading to a down-regulation of mTOR and subsequently inducing the programmed cell death II (autophagy). Cisplatin was previously found to induce

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico