Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU023751

Sigma-Aldrich

MISSION® esiRNA

targeting human IL1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGCCAATCTTCATTGCTCAAGTGTCTGAAGCAGCCATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAGGATGACTTGTTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTGGACCTCTGCCCTCTGGATGGCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAGGGCTTCAGGCAGGCCGCGTCAGTTGTTGTGGCCATGGACAAGCTGAGGAAGATGCTGGTTCCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACCTTCTTTCCCTTCATCTTTGAAGAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACGATGCACCTGTACGATCACTGAACTGCACGCTCCGGGACTCACAGCAAAAAAGCTTGGTGATGTCTGGTCCATATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGA

Ensembl | nº de acceso humano

ENSG00000125538

Nº de acceso NCBI

NM_000576

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IL1B(3553) , IL1B(3553)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dong-Dong Zhu et al.
Cardiovascular diabetology, 15, 42-42 (2016-03-06)
Previous studies have shown that high glucose (HG) induced endothelial cell (EC) damage via a phenotypic transition of EC. There is increasing evidence suggesting the role of inflammatory cytokines in mediated HG-induced EC damage. However, little is known about the
Dhivya Thiyagarajan et al.
PloS one, 10(6), e0129485-e0129485 (2015-06-13)
We have demonstrated that the renal endonuclease DNaseI is up-regulated in mesangial nephritis while down-regulated during progression of the disease. To determine the basis for these reciprocal DNaseI expression profiles we analyse processes accounting for an early increase in renal
Ravi S Keshari et al.
PloS one, 7(10), e48111-e48111 (2012-10-31)
Neutrophils (PMNs) and cytokines have a critical role to play in host defense and systemic inflammatory response syndrome (SIRS). Neutrophil extracellular traps (NETs) have been shown to extracellularly kill pathogens, and inflammatory potential of NETs has been shown. Microbial killing
Sambasivan Venkatasubramanian et al.
PLoS pathogens, 11(2), e1004617-e1004617 (2015-02-07)
In this study, we found that a subpopulation of CD4(+)CD25(+) (85% Foxp3(+)) cells from persons with latent tuberculosis infection (LTBI) inhibits growth of M. tuberculosis (M. tb) in human monocyte-derived macrophages (MDMs). A soluble factor, Rho GDP dissociation inhibitor (D4GDI)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico