Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU023561

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACTCTGTTGCTGGTCCTCAACTTTGAGAGGACAAGATCATTGCAGGATCCTTGTAGTAACTGCCCAGCTGGTACATTCTGTGATAATAACAGGAATCAGATTTGCAGTCCCTGTCCTCCAAATAGTTTCTCCAGCGCAGGTGGACAAAGGACCTGTGACATATGCAGGCAGTGTAAAGGTGTTTTCAGGACCAGGAAGGAGTGTTCCTCCACCAGCAATGCAGAGTGTGACTGCACTCCAGGGTTTCACTGCCTGGGGGCAGGATGCAGCATGTGTGAACAGGATTGTAAACAAGGTCAAGAACTGACAAAAAAAGGTTGTAAAGACTGTTGCTTTGGGACATTTAACGATCAGAAACGTGGCATCTGTCGACCCTGGACAAACTGTTCTTTGGATGGAAAGTCTGTGCTTGTGAATGGGA

Ensembl | nº de acceso humano

ENSG00000049249

Nº de acceso NCBI

NM_001561

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TNFRSF9(3604) , TNFRSF9(3604)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Liang Zhao et al.
Frontiers in cell and developmental biology, 9, 600506-600506 (2021-02-23)
Background: O6-methylguanine-DNA methyltransferase (MGMT) methylation status affects tumor chemo-resistance and the prognosis of glioblastoma (GBM) patients. We aimed to investigate the role of MGMT methylation in the regulation of GBM immunophenotype and discover an effective biomarker to improve prognosis prediction
Bo Li et al.
Mediators of inflammation, 2020, 1649453-1649453 (2020-11-10)
Combination of antiangiogenesis and immunotherapy may be an effective strategy for treatment of solid tumors. Our previous work reported that activation of CD137 signaling promotes intraplaque angiogenesis. A number of studies have demonstrated that vascular endothelial growth factor receptor 2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico