Saltar al contenido
Merck

EHU020691

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCACTTTCCAATCACATCCAAATTCCAGCATGCCTGGTTCAAGAGAAGTTCAGATACACCCGGACTCGGATCAAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGAAGATGAAATTGAATATGAAAACCAAAAAAGGCTGGAAGAAGAGGAGGACTTGAATGTGCTTACATTTGAAGATCTTCTTTGCTTTGCATATCAAGTTGCCAAAGGAATGGAATTTCTGGAATTTAAGTCGTGTGTTCACAGAGACCTGGCCGCCAGGAACGTGCTTGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGGCTCGAGATATCATGAGTGATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGATGGCCCCCGAAAGCCTGTTTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTCATATGGAATATTACTGTGGGAAATCTTCTCACTTGGTGTGAATCCTTACCCTGGCATTCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui-Fang Dong et al.
Gene, 697, 152-158 (2019-02-18)
Neuron damage contributes to ischemic brain injury. Although FMS-like tyrosine kinase-3 (FLT3) plays a critical role in neuron survival, its function and molecular mechanism in cerebral ischemia/reperfusion injury is unclear. In the present study, we exposed SH-SY5Y cells to oxygen
Anna Skwarska et al.
Biochemical pharmacology, 95(4), 238-252 (2015-04-22)
Drugs targeting receptor tyrosine kinase FLT3 are of particular interest since activating FLT3-internal tandem duplication (ITD) mutations abundantly occur in fatal acute myeloid leukemias (AMLs). Imidazoacridinone C-1311, a DNA-reactive inhibitor of topoisomerase II, has been previously shown to be a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico