Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU020571

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCCTAGCTGCTCATGTTTCCCACCTGGAGAATGTGTCAGAGGAAGAAATGAACAGACTCCTGGGAATAGTATTGGATGTGGAATATCTCTTTACCTGTGTCCACAAGGAAGAAGATGCAGATACCAAACAAGTTTATTTCTATCTATTTAAGCTCTTGAGAAAGTCTATTTTACAAAGAGGAAAACCTGTGGTTGAAGGCTCTTTGGAAAAGAAACCCCCATTTGAAAAACCTAGCATTGAACAGGGTGTGAATAACTTTGTGCAGTACAAATTTAGTCACCTGCCAGCAAAAGAAAGGCAAACAATAGTTGAGTTGGCAAAAATGTTCCTAAACCGCATCAACTATTGGCATCTGGAGGCACCATCTCAACGAAGACTGCGATCTCCCAATGATGATATTTCTGGATACAAAGAGAACTACACAAGGTGGCTGTGTTACTGCAACGTGCCACAGTTCTGCGACAGTCTACCTCGGTACGAAACCACACAGGTGTTTG

Ensembl | nº de acceso humano

ENSG00000114166

Nº de acceso NCBI

NM_003884

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KAT2B(8850) , KAT2B(8850)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shiladitya Sengupta et al.
DNA repair, 66-67, 1-10 (2018-04-27)
Posttranslational modifications of DNA repair proteins have been linked to their function. However, it is not clear if posttranslational acetylation affects subcellular localization of these enzymes. Here, we show that the human DNA glycosylase NEIL1, which is involved in repair
Yu-Li Jia et al.
Cell death & disease, 7(10), e2400-e2400 (2016-10-07)
Aberrant autophagic processes have been found to have fundamental roles in the pathogenesis of different kinds of tumors, including hepatocellular carcinoma (HCC). P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), performs its function by acetylating both histone and non-histone proteins. Our
Anna Perearnau et al.
Nucleic acids research, 45(9), 5086-5099 (2017-02-06)
The cyclin-dependent kinase inhibitor p27Kip1 (p27) also behaves as a transcriptional repressor. Data showing that the p300/CBP-associated factor (PCAF) acetylates p27 inducing its degradation suggested that PCAF and p27 could collaborate in the regulation of transcription. However, this possibility remained
X Gai et al.
Cell death & disease, 6, e1712-e1712 (2015-04-10)
P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), has been found to regulate numerous cell signaling pathways controlling cell fate by acetylating both histone and non-histone proteins. We previously reported that PCAF upregulates cell apoptosis by inactivating Serine/Threonine Protein Kinase 1
S-M Jang et al.
Cell death & disease, 6, e1857-e1857 (2015-08-21)
Transcription factor SOX4 has been implicated in skeletal myoblast differentiation through the regulation of Cald1 gene expression; however, the detailed molecular mechanism underlying this process is largely unknown. Here, we demonstrate that SOX4 acetylation at lysine 95 by KAT5 (also

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico